Hollykatland

It's raining nonstop where I am so I'm just picturing the Batfam during a flood.

Red Robin uploads a TikTok from the safety of a roof saying "watch him go!" As Red Hood keeps trying to drive his bike against the current. A big wave comes by and he's slowly dragged downhill. The caption reads "don't drive during floods".

Batman and Robin are on the ground helping civilians out of cars when the intensity doubles and in minutes Damian goes from wading knee deep in the water to swimming. The emergency batfloaties get triggered and he floats away as Bruce fails to grab him by half an inch. "Robin serenely drifting in the current" becomes a meme.

Someone takes a picture of a very flustered spoiler trying to squeeze the water out of her cape. The second she lets go the weight of the water makes her fall ass over backwards. Black Bat ends up giving her her waterproof cape.

Signal makes mirages of sharks in the water to scare the shit out of any criminals. Oracle uploads the recordings with Benny hill as background music. Bludhaven escapes the worst of the storm and Nightwing sends pictures to the group chat patting the barely wet concrete just to rub it in. He still slips on a puddle and eats shit, Barbara sends that to the group chat.

help him

WHATEVER *beams an image of battinson directly into your mind and you can't escape it*

It's so uncool. We can send men to the moon but we can't beam Battinson pics directly to my mind?

this post's hypothetical by itself is already ridiculous but the thing that gets me is how the wording implies two very funny things that become funnier in tandem

1. "Accidentally, the pitcher tosses a Christian baby" means this is a mistake on the pitcher's part. i imagine the pitcher is breastfeeding on the field and they pitch and they look down at their hands and they see the ball still in the glove and they go "fuck"

2. hitting the baby will still win you the game

String identified: tt'ttcataactttgtatgttgttgtatcta ."Accta,ttctaCtaa"atatattc'at.agttcatgtattcatattaattattgatg"c" .ttgtattga

Closest match: Gallinula chloropus genome assembly, chromosome: 5 Common name: Common Moorhen

(image source)

Carrying all those medications around, granted, is an inconvenience. That's why I say combine them!

Why does everyone have the same car?

#that giraffe is being so cute and curious and gentle#and that is running full speed because this is the worst fucking day if his LIFE#like IMAGINE having your butt gently scooted by the snoot of a pressence so massive#your body is not designed to even see high enough to see the top of#abd hes just gently nudging you along as you run for your life as fast as your legs can carry you#giraffe is playing humans are enjoying turtle is living out a cosmic horror story

Vs.

bauhaus

Source: brunaandnatalie

The sweetest, most adorable pair in the world.

https://www.instagram.com/loki.doestricks/profilecard/?igsh=M2xuMnBpajBsNWQy