hey here's a website for downloading any video or image from any website.

works w/ youtube, soundcloud, twitch, twitter (gifs and videos), tumblr (video and audio), and most other websites you're probably lookin to download stuff off of.

for anyone wondering about privacy and whatnot, i'm happy to say that the developers are pretty committed to have 0 trackers and 0 data retention. you can read more in their "about" section, but here's the basic important stuff:

it's football (YTP I made today, just now)

there's this word in Serbian 'vukojebina' which literally means 'the place where wolves go to fuck' but they use it to mean 'in the middle of nowhere'. it sure does the job well, but the visual stayed with me longer than I would have liked it to.

In Croatian it’s “Bogu iza nogu” which means “Behind gods legs” which also evokes some strong imagery

This is a little nightmares character

tgirl stretch marks

this post's hypothetical by itself is already ridiculous but the thing that gets me is how the wording implies two very funny things that become funnier in tandem

1. "Accidentally, the pitcher tosses a Christian baby" means this is a mistake on the pitcher's part. i imagine the pitcher is breastfeeding on the field and they pitch and they look down at their hands and they see the ball still in the glove and they go "fuck"

2. hitting the baby will still win you the game

String identified: tt'ttcataactttgtatgttgttgtatcta ."Accta,ttctaCtaa"atatattc'at.agttcatgtattcatattaattattgatg"c" .ttgtattga

Closest match: Gallinula chloropus genome assembly, chromosome: 5 Common name: Common Moorhen

(image source)

I just got described as an "ad hating commie" by someone because I said a minute of youtube ads is unpleasant. fully spent 5 minutes arguing and defending youtube ads. insane stuff

reblog if you are an ad hating commie

Do not surrender, do not give up, information, kindness, and spite, kill them with spite, if they want to choke us with their rhetoric turn it against them learn more then them, and never give up, vote when you can, not only with your voice and ballot but with your dollar

Everything feels awful right now but it isn't really. We still don't officially have a winner, but regardless of how the presidential election ends up, I wanted to take a minute and find what lights I can in the 3 a.m. darkness. Here's what I know:

* Kentucky overwhelmingly rejected an attempt to undermine the public education system by offering private school vouchers:

* Delaware has elected a transgender woman to the House of Representatives, the first out trans person of any gender ever elected to congress:

* For the first time in history, two Black women will be serving in the senate at the same time, and they are only the fourth and fifth Black women ever elected to the senate:

* New York State has passed a constitutional amendment enshrining the rights of pregnant people (including the right to an abortion), LGBTQIA+ people, the disabled, immigrants regardless of legal status, and other at-risk groups:

* Democrat Josh Stein has beaten self-avowed Nazi Mark Robinson to become governor of North Carolina:

That's everything I know off the top of my head. It's not many bright spots, but it's not zero. I'm going to try to find more and I'll add them to the post. It's the only thing I can think of to do that isn't sobbing and throwing up or looking up Canadian immigration rules.

If you know more good news, I encourage you to add it in reblogs.

* Nevada has amended their constitution to guarantee abortion rights, overturning a state ban:

* Colorado has passed amendment 79, guaranteeing the right to an abortion, with more than a 20 point spread between the Yes and No vote:

* Maryland Question 1, also focused on reproductive rights and abortion, has passed as well: https://www.cnn.com/election/2024/results/maryland/issue-1

* Likewise, Amendment 3 has passed in Missouri, overturning a near-total ban to add reproductive rights to the state constitution:

* Arizona Proposition 139 to protect abortion rights also passed:

Every glimmer helps.

Rage, rage against the dying of the light.

* New Jersey has elected the first Korean-American senator in history:

Track your ballot if you already voted!

I always knew there was an undeniable pain in his eye

I’M SORRY THEY NAMED THE WAVE 3 CLEAR/KING SALMONID APPEARS SONG W H A T

YOU HEARD RIGHT THEY NAMED IT “Go Off, King!”