broadlyaudrey-deactivated202106
i post cringe to test my followers’ faith
nightcrawlerowl reblogged
jhonenyo-deactivated20210208
is this your card?
etrianodysseyobsession
This video perfectly captures the trans girl aesthetic and I’m not even angry he’s cis I’m just impressed he managed to, purely by accident, hit every fucking note of a perfect trans girl gag video like dammit I wish he played on my team.
nightcrawlerowl reblogged
nightcrawlerowl reblogged
spencerthespacer-deactivated202
cazador-red
Amazing
nightcrawlerowl reblogged
Should I watch this Yes or No
nobody said anything so im just gonna watch it anyways, gotta say this is some high budget porn even the set is accurate
this actually looks like a screenshot from tos, incredible
Spock is British 😭
She's sucking his dick and he's checking his tricorder??? im gonna cry that's so spock
wow just like in Space seed
i'm so charmed by the fact that you can tell some of the actor has watch star trek before lmao, Spock says illogical and he does the vulcan finger kissing with the girl, Kirk does the patented shatner pauses and still eyefucks spock
Khan released a virus into the air system and Dr McCoy learns that a spike of adrenaline will cure the sickness, the dialogue is incredible.
McCoy: you've been infected with a virus but a spike of adrenaline will trigger the antibodies, Christine I need you to do it Chapel: Have an orgasm? McCoy: YES! (hands her a vibrator) for god sakes use it!
incredible leap of logic Christine
Kirk and Spock got infected with the virus so they have to double team Uhura ✊😔 but spock is reluctant which gave us the awesome line
Kirk: Dammit Spock you're half human, you've gotta fuck her
oop! turn out spock WASN'T infected? he just wanted to fuck Uhura with kirk
They even did the star trek happy ending 😭
with the Spock and McCoy bickering too hfjkrahgjkslbuelgw
Spock: There is one thing that still puzzles me doctor Bones: Only ONE thing, Mr. Spock Spock: Isn't sickbay sufficiently stocked with endorphins hyposprays Bones: 🙄
nightcrawlerowl reblogged
nightcrawlerowl reblogged
The Biden/Harris administration is enforcing a siege on Lebanon as Israel continues to bomb and wipe out villages.
The Israelis have been airstriking Dhahiya, Southern Beirut nonstop all day today, exceeding 10 major strikes on random buildings with no end in sight. Evacuation orders were covering the entire neighborhood.
"content has been removed for violating tumblr's user guidelines"
hi uh. what guidelines is that violating exactly?
Are you fucking serious...
Because we're not gonna let zionist tumblr members or employees get away with this shit.
nightcrawlerowl reblogged
nightcrawlerowl reblogged
The number of people in the notes of this being like “lol i’m the motorist” with 0 sense of shame or self awareness is crazy. You should all get your licenses taken away
I get anxious around cyclists so I made this
nightcrawlerowl reblogged
the front seat of the car is a type of confessional
i genuinely think that physically it’s easier to have hard conversations when you’re both facing forward, not having to look at each other. the catholic church knew this also
nightcrawlerowl reblogged
THE WAY SHE POSED AFTERWARDS HFKFBDK
My artistic rendition:
nightcrawlerowl reblogged
*bursts into the fandom 30 years late* Oh my gosh you guys, have you heard of this thing called Inuyasha?!
nightcrawlerowl reblogged
Christmas as a cultural icon is starting to get really dystopian in a climate sense, december has historically been a time of year in which there would be snow in a significant portion of europe and north america, and the fact that its not even icy this time of year and all the christmas songs and decorations reference a time of year that will likely never exist in the same way again in my life time is so strange.
(Stares in bewildered Australian) And?
I swear to fucking god if I see another post about someone from the southern hemisphere saying shit like this. No one on Tumblr is capable of understanding when someone is talking about their own experience and be normal about it. I don't even really give a shit about the Christmas side of this just that climate change has gotten so bad that there is no longer ice in Scotland in December and you should be worried about that actually. Imagine if people came on here being like I don't give a shit about Australian wildfires because it doesn't effect me
Just saying, while I share the sentiment of being weirded out by increasingly warm winters, the idea of "snowy Christmas" is profoundly anglocentric, even within Europe.
The concept of a "white Christmas" is pretty rare to experience anywhere in Europe southern than Amsterdam (so 3/4ths of Europe, population-wise). Hell, even some of the nordic capitals (Copenhagen and Stockholm) only get white Christmas maybe once per decade or so. Sure, it can snow everywhere, but in December? It's rarely enough for the snow to actually settle.
So yeah, not really a very significant portion of Europe, really.
Oh my god you people can't read anything without being mad that it's not about you.
nightcrawlerowl reblogged
“hi welcome to mcdonalds what can i get for you?”
“yeah can i get a deluxe quarter pounder with cheese?”
“absolutely, do you want the meal or just the sandwich?’
“uuuuuh hold on”
*fishes something out of my pocket*
“mikey what do i do?”
“get the fries. youll need the energy in the coming days”
*stuffs it back in my pocket*
“uhh yes please the meal would be great”
world heritage post
String identified: ctcaatcagtacagtaattcatattattactgtctatgtttgtcgattacctatagattagt
Closest match: Udea ferrugalis genome assembly, chromosome: 11 Common name: Rusty Dot Pearl
nightcrawlerowl reblogged
is there anyone out there with a nyt cooking subscription
will they send me the chamomile tea cake with strawberry icing recipe
This buttery, chamomile tea-scented loaf is a sweet pop symphony, the Abba of cakes. A pot of flowery, just-brewed chamomile isn’t required for drinking with slices of this tender loaf but is strongly recommended. In life and in food, you always need balance: A sip or two of the grassy, herbal tea between bites of this cake counters the sweetness, as do freeze-dried strawberries, which lend tartness and a naturally pink hue to the lemony glaze. This everyday loaf will keep on the counter for 3 to 4 days; be sure the cut side is always well wrapped.
Ingredients Yield: One 9-inch loaf ½ cup/115 grams unsalted butter 2 tablespoons/6 grams chamomile tea (from 4 to 6 tea bags), crushed fine if coarse 1 cup/240 milliliters whole milk Nonstick cooking spray 1 cup/200 grams granulated sugar ½ teaspoon coarse kosher salt 2 large eggs 1 large lemon 2 teaspoons baking powder 1 teaspoon pure vanilla extract 1½ cups/192 grams all-purpose flour 1 cup/124 grams confectioners’ sugar ½ cup/8 grams freeze-dried strawberries
Preparation Step 1 In a small saucepan, melt the butter over medium heat. Add 1 tablespoon chamomile to a large mixing bowl. Pour the hot melted butter over the chamomile and stir. Set aside to steep and cool completely, about 1 hour. Step 2 Use the same saucepan (without washing it out) to bring the milk to a simmer over medium-high heat, keeping watch so it doesn’t boil over. Remove from the heat, and stir the remaining 1 tablespoon chamomile into the hot milk. Set aside to steep and cool completely, about 1 hour. Step 3 Heat oven to 350 degrees. Grease a 9-by-5-inch loaf pan with the nonstick cooking spray and line with parchment paper so the long sides of the pan have a couple of inches of overhang to make lifting the finished cake out easier. Step 4 Add the sugar and salt to the bowl with the butter, and whisk until smooth and thick, about 1 minute. Add the eggs, 1 at a time, vigorously whisking to combine after each addition. Zest the lemon into the bowl; add the baking powder and vanilla, and whisk until incorporated. Add the flour and stream in the milk mixture while whisking continuously until no streaks of flour remain. Step 5 Transfer the batter to the prepared pan and bake until a skewer or cake tester inserted in the center comes out clean (a few crumbs are OK, but you should see no wet batter), 40 to 45 minutes. Cool in the pan on a rack for 30 minutes. Step 6 While the cake cools, make the icing: Into a medium bowl, squeeze 2 tablespoons juice from the zested lemon, then add the confectioners’ sugar. Place the dehydrated strawberries in a fine-mesh sieve set over the bowl and, using your fingers, crush the brittle berries and press the red-pink powder through the sieve and into the sugar. (The more you do this, the redder your icing will be.) Whisk until smooth. Step 7 If needed, run a knife along the edges of the cake to release it from the pan. Holding the 2 sides of overhanging parchment, lift the cake out and place it on a plate, cake stand or cutting board. Discard the parchment. Pour the icing over the cake, using a spoon to push the icing to the edges of the cake to encourage the icing to drip down the sides dramatically. Cool the cake completely and let the icing set.
We out here torrenting recipes now? Reblog
Reminder - in the US, you can't copyright recipes. (This is why online recipes tend to have stories wrapped around them - you /can/ copyright the story. But the recipe directions are exempt from copyright.
nightcrawlerowl reblogged
THE WAY SHE POSED AFTERWARDS HFKFBDK
My artistic rendition: